foxj1a

Ensembl ID:
ENSDARG00000059545
ZFIN ID:
ZDB-GENE-060929-1178
Description:
forkhead box protein J1 [Source:RefSeq peptide;Acc:NP_001070174]
Human Orthologue:
FOXJ1
Human Description:
forkhead box J1 [Source:HGNC Symbol;Acc:3816]
Mouse Orthologue:
Foxj1
Mouse Description:
forkhead box J1 Gene [Source:MGI Symbol;Acc:MGI:1347474]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2090 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa2090
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082866 Nonsense 308 458 3 3
Genomic Location:
Chromosome 3 (position 61265158)
KASP Assay ID:
554-2553.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAAGCCACAATGTTGAGTTGCTGGATCTCCGGGAAGGGAACCAACAAA[C/T]GAAAACAGCCKYATAACCACAGGACTGGAAAAACTCCTCGACGCTCAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y32jm162