PAPPA (1 of 2)

Ensembl ID:
ENSDARG00000059544
Description:
pregnancy-associated plasma protein A, pappalysin 1 [Source:HGNC Symbol;Acc:8602]
Human Orthologue:
PAPPA
Human Description:
pregnancy-associated plasma protein A, pappalysin 1 [Source:HGNC Symbol;Acc:8602]
Mouse Orthologue:
Pappa
Mouse Description:
pregnancy-associated plasma protein A Gene [Source:MGI Symbol;Acc:MGI:97479]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17987 Nonsense Available for shipment Available now
sa33777 Essential Splice Site Mutation detected in F1 DNA During 2017
sa25323 Nonsense Mutation detected in F1 DNA During 2017
sa17783 Nonsense Available for shipment Available now
sa33778 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa17987
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082858 Nonsense 135 1591 2 24
Genomic Location (Zv9):
Chromosome 5 (position 73416542)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 69617703
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTYAACTGTATTTATTATTGTACTTTCCCACTTAYAGGTCTCTTCGAC[A/T]AATGCTTCTACGCCTCTAGTGATCGTGGATGGCTCTTGGGAATTAAATCY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33777
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082858 Essential Splice Site 490 1591 4 24
Genomic Location (Zv9):
Chromosome 5 (position 73434148)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 69600097
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATCTAGACATACGCGTATGTTCACTCTCCCTCTCCATCTGTGACTCC[A/T]GGGCCTATCTAGATGTGAAGGAGCTGAAAGAGATCCTCAAGCTGGACGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25323
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082858 Nonsense 801 1591 8 24
Genomic Location (Zv9):
Chromosome 5 (position 73470851)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 69638001
KASP Assay ID:
554-7515.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATATGCGGTGGTCCCCGATTCCCTGACAGTTTGGGTCACTTTCTCCTCC[C/T]AAGACGAAACGGTTCTTCCAGCAATCCACAATATCATCCTGTTGACCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17783
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082858 Nonsense 1078 1591 14 24
Genomic Location (Zv9):
Chromosome 5 (position 73520404)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 69687554
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTGGTTTCCATGYCGAGAGGCTCACAGTGTTCCCTGGTATCCCCCGTA[T/A]TGGTTGAAGGTGAGCTGTCTTTAWCATTGTAGTTTWATTTTATTTATTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33778
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082858 Essential Splice Site 1082 1591 15 24
Genomic Location (Zv9):
Chromosome 5 (position 73520629)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 69687779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTATATACTTCATCAGCATAAGCGTAAGAGTAAATCTTGTCTCCGAC[A/T]GGCTTATTTCTCTCATCCTATGGTTGCTGCTGCTGTTATCATCCATTTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Identification of ten loci associated with height highlights new biological pathways in human growth. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link