LOC565205

Ensembl ID:
ENSDARG00000059534
Human Orthologue:
JPH3
Human Description:
junctophilin 3 [Source:HGNC Symbol;Acc:14203]
Mouse Orthologue:
Jph3
Mouse Description:
junctophilin 3 Gene [Source:MGI Symbol;Acc:MGI:1891497]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13918 Nonsense Available for shipment Available now
sa18407 Nonsense Available for shipment Available now
sa7091 Nonsense Mutation detected in F1 DNA During 2014
sa15894 Essential Splice Site Available for shipment Available now
sa21097 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13918
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082842 Nonsense 217 887 2 5
Genomic Location:
Chromosome 7 (position 58050945)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCTCACAGTGAAGCAGACAGGCACAGGAAGAGGAAAGGCCGCTTCCGA[C/T]AGTCCATACTWAGCGGTTTAAAACTGCGGAGGTCTGAGTCCAAGAGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18407
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082842 Nonsense 238 887 2 5
Genomic Location:
Chromosome 7 (position 58050881)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGTTTAAAACTGCGGAGGTCTGAGTCCAAGAGCTCTCTAGCCAGCCAGT[T/A]AARCAAGCAGAGTTCCTTCTGCAGCGAGGCAGGTATGAGYACCGTCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7091
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082842 Nonsense 344 887 2 5
Genomic Location:
Chromosome 7 (position 58050564)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAARGAAGAGGGAAAATAYAAGCAGAATGTTCTGGTGAGTGGCAAACGG[A/T]AAAACCTGATACCACTCCGAACAAGCAAAATCCGGGAAAAGGTGGATCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15894
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082842 Essential Splice Site 424 887 3 5
Genomic Location:
Chromosome 7 (position 58049601)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGCTATAGCCAAAGAACTTTCCCCCTCTTTCCATCAYTATGGRAATGG[T/A]AGGWTAAAATACACTATAGCRCTAAATYTGTAATGSATATAAAATGCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21097
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082842 Nonsense 560 887 4 5
Genomic Location:
Chromosome 7 (position 58048201)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCATCCCTGCTGGAAGAGGAGATCAGTCACATTAATGGACATGAGAACT[C/A]AACTCATCATCCATGGGAGAACGGCTCCTCTAACCACAAGCCCATCGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4gh568ns