LOC799082

Ensembl ID:
ENSDARG00000059507
Human Orthologue:
F2R
Human Description:
coagulation factor II (thrombin) receptor [Source:HGNC Symbol;Acc:3537]
Mouse Orthologue:
F2r
Mouse Description:
coagulation factor II (thrombin) receptor Gene [Source:MGI Symbol;Acc:MGI:101802]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17453 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17453
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082790 Nonsense 350 462 4 4
Genomic Location:
Chromosome 21 (position 7350763)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCGTGCAAAGTCCAACCGATTATCGAAATCTCCATCATGGTTGRAAAAA[C/T]GACGGAGAGCTGCGATTATGCTTATCGCCAWGTTGTCTGAGTTTATGGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3iux02pa