si:dkey-209e8.1

Ensembl ID:
ENSDARG00000059475
ZFIN ID:
ZDB-GENE-060503-811
Human Orthologue:
KIAA1543
Human Description:
KIAA1543 [Source:HGNC Symbol;Acc:29307]
Mouse Orthologue:
2310057J16Rik
Mouse Description:
RIKEN cDNA 2310057J16 gene Gene [Source:MGI Symbol;Acc:MGI:1916947]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25262 Nonsense Mutation detected in F1 DNA During 2017
sa40168 Nonsense Mutation detected in F1 DNA During 2017
sa33318 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25262
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082715 Nonsense 203 1420 4 17
Genomic Location (Zv9):
Chromosome 3 (position 54063976)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53171291
KASP Assay ID:
554-7527.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAACAAACTGAAGGTACACAAATCGACACATCTCAGTCTGCTGAACCA[C/T]AGCCTGTTCAACCCTCGGTAAGAAACTAACAAGCTTGACAGACTTGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40168
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082715 Nonsense 643 1420 11 17
Genomic Location (Zv9):
Chromosome 3 (position 54083171)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53190486
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGAAGCTGGTTCCAGAACAGGTACGGCCCAGTGAGCCAGAGGCACCA[C/T]AAATGACAACGTGGGCCAAGAAATCAGAGGAGAGTCCCAGTAAGAGTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33318
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082715 Nonsense 1106 1420 12 17
Genomic Location (Zv9):
Chromosome 3 (position 54084638)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53191953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCCGCATTACTTGAGAAACAACAGAAGCGAGCAGAGGAGATGAAAAGA[C/T]GAAAACAGGAACAAGAGAGAGAAAGGGAGGCAAGGTGAGGCTTACCAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link