mlxip

Ensembl ID:
ENSDARG00000059474
ZFIN ID:
ZDB-GENE-060526-8
Description:
Novel protein similar to human and mouse MLX interactin protein (MLXIP) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
MLXIP
Human Description:
MLX interacting protein [Source:HGNC Symbol;Acc:17055]
Mouse Orthologue:
Mlxip
Mouse Description:
MLX interacting protein Gene [Source:MGI Symbol;Acc:MGI:2141183]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8759 Nonsense Mutation detected in F1 DNA During 2014
sa11142 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8759
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082702 Nonsense 480 860 9 18
ENSDART00000134673 Nonsense 475 525 9 10
ENSDART00000144092 None None 241 None 6
Genomic Location:
Chromosome 5 (position 70325106)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCGCCRTCTCCACAGCCTGTRGTCTCCAGCTCTGCCTCGCTCGGCTCA[C/T]AGCCAGTCAACTTCGCCTTRCCCAAATCCATCCAGCCYCCMATCTCTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11142
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082702 Essential Splice Site 821 860 None 18
ENSDART00000134673 None None 525 None 10
ENSDART00000144092 Essential Splice Site 202 241 None 6
Genomic Location:
Chromosome 5 (position 70316147)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGTGTGTGTGTGTGTNNNNASAYTAACAATATGTTTCTCTGTCCTMC[A/T]GTGGTGCTCAGGACRTTACGGCAGCTCTGCACCAGCACCTCCATCCTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3cuj4v63