LOC100334982

Ensembl ID:
ENSDARG00000059473
Human Orthologue:
KANK4
Human Description:
KN motif and ankyrin repeat domains 4 [Source:HGNC Symbol;Acc:27263]
Mouse Orthologue:
Kank4
Mouse Description:
KN motif and ankyrin repeat domains 4 Gene [Source:MGI Symbol;Acc:MGI:3043381]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20728 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20728
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082698 Essential Splice Site 847 1179 3 9
Genomic Location:
Chromosome 6 (position 32179400)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAATGGGGGAGCGAAGAAGAACTTGAAGTTTGTTGGCGTAAATGGAGGG[T/C]ATGTGGATTTTATACATTTTTGGCATATTTTTCTGCATTTGAAACCTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2p61zcoy