si:ch211-271b14.7

Ensembl ID:
ENSDARG00000059466
ZFIN ID:
ZDB-GENE-060531-55
Description:
Novel protein similar to vertebrate WAS protein family, member 3 (WASF3) [Source:UniProtKB/TrEMBL;Ac
Human Orthologue:
WASF3
Human Description:
WAS protein family, member 3 [Source:HGNC Symbol;Acc:12734]
Mouse Orthologue:
Wasf3
Mouse Description:
WAS protein family, member 3 Gene [Source:MGI Symbol;Acc:MGI:2658986]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7015 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40600 Essential Splice Site Mutation detected in F1 DNA During 2017
sa14326 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7015
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082688 Essential Splice Site 89 484 2 13
ENSDART00000143199 Essential Splice Site 89 481 2 8
Genomic Location (Zv9):
Chromosome 5 (position 70952733)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67338418
KASP Assay ID:
554-5279.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACCGTCTCGCAGTCAAGGTCACTCAGCTGGACTCWAGCGTGGAAGAAG[G/A]TCAGTCAAAAACCAAAATGCACAGTGCATTYAAAAAAGCAGTCACTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40600
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082688 Essential Splice Site 138 484 5 13
ENSDART00000143199   None 481 None 8
Genomic Location (Zv9):
Chromosome 5 (position 70954300)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67336851
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGCAACTTTCAGTTTACGCAGACTTTAAGATGTTTATGTGTTTTGTT[T/A]GTTTTGTCTAGGGATGATCACATTGACGGAATTAAGTTCTACACAGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14326
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082688 Nonsense 476 484 13 13
ENSDART00000143199 Nonsense 473 481 8 8
Genomic Location (Zv9):
Chromosome 5 (position 70961661)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67329490
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTCTCCCGCCGCATCGCCGTCGAGTAYAGCGACKCAGAAGACGACTCA[G/T]AGCTGGATGACAACGAATGGTCAGACTGAAGACTGTCAGCNNNNCACACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link