mepce

Ensembl ID:
ENSDARG00000059461
ZFIN ID:
ZDB-GENE-030131-3936
Description:
7SK snRNA methylphosphate capping enzyme [Source:RefSeq peptide;Acc:NP_001122001]
Human Orthologue:
MEPCE
Human Description:
methylphosphate capping enzyme [Source:HGNC Symbol;Acc:20247]
Mouse Orthologue:
Mepce
Mouse Description:
methylphosphate capping enzyme Gene [Source:MGI Symbol;Acc:MGI:106477]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31491 Nonsense Mutation detected in F1 DNA During 2016
sa5340 Nonsense Mutation detected in F1 DNA During 2016
sa33774 Essential Splice Site Mutation detected in F1 DNA During 2016
sa3568 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa31491
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082674 Nonsense 280 528 2 6
ENSDART00000141699 Nonsense 405 701 2 5
Genomic Location:
Chromosome 5 (position 71683213)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCGCATTCGTGTTATGAATCCGGATTGGTTCAGAGGGAAGGATGTGT[T/A]GGATCTGGGATGCAACACTGGCCACCTGACTCTGTTTATCGCAAAAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5340
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082674 Nonsense 317 528 2 6
ENSDART00000141699 Nonsense 442 701 2 5
Genomic Location:
Chromosome 5 (position 71683103)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAGTATTKTGGGCCTGGATATTGACGGATCGCTGATACATGCTGCTCGA[C/T]AGAATATAAGACACTACCTCTCTGAGGTCCAAGTGCAGCACTCCCGACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33774
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082674 Essential Splice Site 470 528 4 6
ENSDART00000141699 Essential Splice Site 643 701 3 5
Genomic Location:
Chromosome 5 (position 71677832)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGAGCCCCAGCCCTGGAGCTCCTACAACAAGAGGAAGAAGCTCACCG[T/C]AAGGCCACAACATTTTCATCACATCACTGATCATTTAAGATGCACAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3568
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082674 Essential Splice Site 511 528 5 6
ENSDART00000141699 Essential Splice Site 684 701 4 5
Genomic Location:
Chromosome 5 (position 71673637)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCTTCTCCAGTTATGAGCTCATTGGGACGTCRCAAAACTACTCCAAAG[G/A]TCAGAGCTTTGNATATATATATATCAGAGATGCCCAAAYTAGGGCCTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link