mepce

Ensembl ID:
ENSDARG00000059461
ZFIN ID:
ZDB-GENE-030131-3936
Description:
7SK snRNA methylphosphate capping enzyme [Source:RefSeq peptide;Acc:NP_001122001]
Human Orthologue:
MEPCE
Human Description:
methylphosphate capping enzyme [Source:HGNC Symbol;Acc:20247]
Mouse Orthologue:
Mepce
Mouse Description:
methylphosphate capping enzyme Gene [Source:MGI Symbol;Acc:MGI:106477]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31491 Nonsense Available for shipment Available now
sa33774 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa31491
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082674 Nonsense 280 528 2 6
ENSDART00000141699 Nonsense 405 701 2 5
Genomic Location (Zv9):
Chromosome 5 (position 71683213)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68007831
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCGCATTCGTGTTATGAATCCGGATTGGTTCAGAGGGAAGGATGTGT[T/A]GGATCTGGGATGCAACACTGGCCACCTGACTCTGTTTATCGCAAAAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33774
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082674 Essential Splice Site 470 528 4 6
ENSDART00000141699 Essential Splice Site 643 701 3 5
Genomic Location (Zv9):
Chromosome 5 (position 71677832)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68002450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGAGCCCCAGCCCTGGAGCTCCTACAACAAGAGGAAGAAGCTCACCG[T/C]AAGGCCACAACATTTTCATCACATCACTGATCATTTAAGATGCACAACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link