mepce

Ensembl ID:
ENSDARG00000059461
ZFIN ID:
ZDB-GENE-030131-3936
Description:
7SK snRNA methylphosphate capping enzyme [Source:RefSeq peptide;Acc:NP_001122001]
Human Orthologue:
MEPCE
Human Description:
methylphosphate capping enzyme [Source:HGNC Symbol;Acc:20247]
Mouse Orthologue:
Mepce
Mouse Description:
methylphosphate capping enzyme Gene [Source:MGI Symbol;Acc:MGI:106477]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5340 Nonsense Mutation detected in F1 DNA During 2014
sa3568 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5340
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082674 Nonsense 317 528 2 6
ENSDART00000141699 Nonsense 442 701 2 5
Genomic Location:
Chromosome 5 (position 71683103)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAGTATTKTGGGCCTGGATATTGACGGATCGCTGATACATGCTGCTCGA[C/T]AGAATATAAGACACTACCTCTCTGAGGTCCAAGTGCAGCACTCCCGACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3568
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082674 Essential Splice Site 511 528 5 6
ENSDART00000141699 Essential Splice Site 684 701 4 5
Genomic Location:
Chromosome 5 (position 71673637)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCTTCTCCAGTTATGAGCTCATTGGGACGTCRCAAAACTACTCCAAAG[G/A]TCAGAGCTTTGNATATATATATATCAGAGATGCCCAAAYTAGGGCCTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wexow5lq