SBF2

Ensembl ID:
ENSDARG00000059460
Description:
SET binding factor 2 [Source:HGNC Symbol;Acc:2135]
Human Orthologue:
SBF2
Human Description:
SET binding factor 2 [Source:HGNC Symbol;Acc:2135]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6088 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21129 Essential Splice Site Available for shipment Available now
sa2358 Essential Splice Site F2 line generated During 2017
sa34231 Nonsense Mutation detected in F1 DNA During 2017
sa38653 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6088
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082664 Essential Splice Site 255 1898 7 42
Genomic Location (Zv9):
Chromosome 7 (position 68898740)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 66776761
KASP Assay ID:
554-3858.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGGCCTGCCGTGCCTTAGAGACCCTCATGTTTCCTCTTAAATACAGG[T/A]GAGTCAAGACTAGGGCTACTTTTGTCTTTTTCAAATATTCCCCNAAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21129
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082664 Essential Splice Site 469 1898 13 42
Genomic Location (Zv9):
Chromosome 7 (position 68917621)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 66795642
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAACTCCAGAAGCGCTTGAGGGAGCTGTCCGAGCAGCTTTACAAAAAC[G/A]TAAGCACATGACGCTGATTCTCATGTCCCTTCCGTCAGGTGTTTGAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2358
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082664 Essential Splice Site 648 1898 18 42
Genomic Location (Zv9):
Chromosome 7 (position 68977578)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 66855599
KASP Assay ID:
554-2789.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTTAGCAGACTGCCTTGTGCTGCCCGCTGATCCATCTTTTTGCTTGC[A/T]GAAACTGGCAGSTGGAGTGGATCAGTTCGCCTACACCTGCATCCAGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34231
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082664 Nonsense 757 1898 19 42
Genomic Location (Zv9):
Chromosome 7 (position 68980275)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 66858296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTGGTGAAGAGTGAGGAGAGCACAGTGTTCAGTCAGGCCATCCACTA[C/A]GCCAGCCTGATGGTTTACCTGCTCGTCCCATTGGACACCAGCAAAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38653
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082664 Essential Splice Site 1294 1898 30 42
Genomic Location (Zv9):
Chromosome 7 (position 69034456)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 66912477
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTCCTGTTTCTCCGTGCCATCAACAACTCCTGCACCTCTAATCTACCA[G/A]TACTCGGGTACAGGGATAAACTTTTCACTCACTCAAACCAAAAAGCTTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link