PTPRD (2 of 2)

Ensembl ID:
ENSDARG00000059452
Description:
protein tyrosine phosphatase, receptor type, D [Source:HGNC Symbol;Acc:9668]
Human Orthologue:
PTPRD
Human Description:
protein tyrosine phosphatase, receptor type, D [Source:HGNC Symbol;Acc:9668]
Mouse Orthologue:
Ptprd
Mouse Description:
protein tyrosine phosphatase, receptor type, D Gene [Source:MGI Symbol;Acc:MGI:97812]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34262 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34263 Nonsense Mutation detected in F1 DNA During 2017
sa6089 Nonsense Mutation detected in F1 DNA During 2017
sa2384 Nonsense F2 line generated During 2017
sa34264 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34262
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082630 Essential Splice Site 191 1033 7 20
Genomic Location (Zv9):
Chromosome 7 (position 76969961)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150000.1 19531
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTGTTCCACATAATTGAAATCCACTAATTCCCTTTTTATTTTGCTCCA[G/A]CTTTACCGAAGCCACCAGGTGTTCCCCAGGTAACCGAACGCACGGCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34263
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082630 Nonsense 248 1033 7 20
Genomic Location (Zv9):
Chromosome 7 (position 76970134)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150000.1 19704
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCTGAGGACTCTTTTAAAGAGATTGATGGAGTTGCTACCACTCGATA[C/A]AGCGTGGGCGGGCTGAGTCCTTACTCTGACTACCAATTTAGAGTAGTCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6089
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082630 Nonsense 603 1033 12 20
Genomic Location (Zv9):
Chromosome 7 (position 76984841)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150000.1 34411
KASP Assay ID:
554-3676.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGRATGTCAGCCGCTCACACACTCTCTGCTCTCTACCTAGGGCTTACTA[C/A]ATAGTGGTGGTRCCACTGAAGAAACAGCGGCCGGGGAAGTTCATCAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2384
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082630 Nonsense 721 1033 14 20
Genomic Location (Zv9):
Chromosome 7 (position 76990604)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150000.1 40174
KASP Assay ID:
554-3374.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCTGCCAGCCCGTACTCAGACCCAGTGGTGTTCGCAGACATCGACCCG[C/T]AGCCCATCATTGATGAAGAGGAGGGTCTGATCTGGGTTGTTGGACCGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34264
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082630 Nonsense 909 1033 18 20
Genomic Location (Zv9):
Chromosome 7 (position 77018407)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150000.1 67977
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGAGCGCTGCCCGAGACCTTCGGAGACTTCTGGAGGATGATCTGGGAA[C/T]AGCGGAGTGCAAACATCGTCATGATGACCCGACTGGAGGAGCGGTCCAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link