LOC555807

Ensembl ID:
ENSDARG00000059438
Human Orthologue:
GALNTL4
Human Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 4 [Source:HGNC
Mouse Orthologue:
Galntl4
Mouse Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 4 Gene [Source

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5453 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5453
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082604 Nonsense 89 609 2 11
Genomic Location:
Chromosome 7 (position 67682376)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTCTCTGTTTGACCCTCACAGAGTCGCCRCTGAAAGGAGATGACAAT[C/T]AAGTGGATCGATCTTTTGCTGACTCATCCTTGTTTAACCACTGGGGCCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bkto2h73