fsd1l

Ensembl ID:
ENSDARG00000059432
ZFIN ID:
ZDB-GENE-070501-9
Description:
Novel protein similar to H.sapiens FSD1, fibronectin type III and SPRY domain containing 1 (FSD1) [S
Human Orthologue:
FSD1L
Human Description:
fibronectin type III and SPRY domain containing 1-like [Source:HGNC Symbol;Acc:13753]
Mouse Orthologue:
Fsd1l
Mouse Description:
fibronectin type III and SPRY domain containing 1-like Gene [Source:MGI Symbol;Acc:MGI:2442443]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20593 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12348 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20593
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082622 Essential Splice Site 114 501 4 13
ENSDART00000143482 Essential Splice Site 116 544 5 14
Genomic Location:
Chromosome 5 (position 72858427)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTAACCACCTGCTGTTTTTTCCTCTCCTTCTCTTTATCTCCATGCTCA[A/G]GGCTGCCAAACAGATCAAAGATAGGTACAGTATACGTTCCTCAGTATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12348
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082622 Essential Splice Site 121 501 4 13
ENSDART00000143482 Essential Splice Site 123 544 5 14
Genomic Location:
Chromosome 5 (position 72858452)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCTTCTCTTTATCTCCATGCTCAAGGCTGCCAAACAGATCAAAGATAG[G/A]TACAGTATACGTTCCTCAGTATGTGAATGTGTGACAACTGCACGAGTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1lj1hmpr