si:ch211-188g24.2

Ensembl ID:
ENSDARG00000059424
ZFIN ID:
ZDB-GENE-060526-65
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2CEX5]
Human Orthologue:
RNF215
Human Description:
ring finger protein 215 [Source:HGNC Symbol;Acc:33434]
Mouse Orthologue:
Rnf215
Mouse Description:
ring finger protein 215 Gene [Source:MGI Symbol;Acc:MGI:1918923]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20371 Nonsense Available for shipment Available now
sa26427 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20371
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082583   None 277 None 8
ENSDART00000144898 Nonsense 75 378 2 9
Genomic Location (Zv9):
Chromosome 5 (position 19664819)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 17539446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGTGACATGCTTCTGTTTTGCCATGGCAGGTAAAGGATGAAGCTCTT[A/T]AAAGCAACAGTGAAATCAATGATGGAAAGGATCCAGACCCTTGGATAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26427
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082583 Essential Splice Site 41 277 1 8
ENSDART00000144898 Essential Splice Site 118 378 2 9
Genomic Location (Zv9):
Chromosome 5 (position 19664951)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 17539314
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCCAGCAACAGCAACCAGGAGTCCTTTGCTGCATCTATGGTTAATAAG[G/A]TATTTAATAAAATTTTTTACTATCTACACTAAAATCTCTTCCTGATCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link