rictora

Ensembl ID:
ENSDARG00000059414
ZFIN ID:
ZDB-GENE-060526-49
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2CE46]
Human Orthologue:
RICTOR
Human Description:
RPTOR independent companion of MTOR, complex 2 [Source:HGNC Symbol;Acc:28611]
Mouse Orthologue:
Rictor
Mouse Description:
RPTOR independent companion of MTOR, complex 2 Gene [Source:MGI Symbol;Acc:MGI:1926007]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26397 Essential Splice Site Mutation detected in F1 DNA During 2017
sa15967 Nonsense Available for shipment Available now
sa44598 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26397
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082536 Essential Splice Site 412 795 13 23
ENSDART00000134379 Essential Splice Site 492 1614 15 35
Genomic Location (Zv9):
Chromosome 5 (position 7722057)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8077004
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGCAAAACCTGGACTGGAACTGGATTTTGATCATCACTATACTGAAG[G/A]TAAAAACCCACATTTAGTTATAAACAAATGTAATTTTATGTTTAGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15967
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082536 Nonsense 614 795 18 23
ENSDART00000134379 Nonsense 693 1614 20 35
Genomic Location (Zv9):
Chromosome 5 (position 7733726)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8065335
KASP Assay ID:
2259-5398.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCCAATGTTGAGTTCTTCAGTAACTGGGGGATGGAGCTGCTGGTCACG[C/T]AGTTGCACGACCACAAYAAAACCATCTCAATGGAGGCGCTCGAYATTCKG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44598
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082536 Nonsense 710 795 21 23
ENSDART00000134379 Nonsense 789 1614 23 35
Genomic Location (Zv9):
Chromosome 5 (position 7738725)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATATGTGGACATGATTGAAGAGCAGCTGAATGAAGCTCTTACAACATA[T/A]CGCAAACCTGTCGACGGAGACAACTACGTCAGGCGCAGCAACCAAAGGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link