rictora

Ensembl ID:
ENSDARG00000059414
ZFIN ID:
ZDB-GENE-060526-49
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2CE46]
Human Orthologue:
RICTOR
Human Description:
RPTOR independent companion of MTOR, complex 2 [Source:HGNC Symbol;Acc:28611]
Mouse Orthologue:
Rictor
Mouse Description:
RPTOR independent companion of MTOR, complex 2 Gene [Source:MGI Symbol;Acc:MGI:1926007]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26397 Essential Splice Site Mutation detected in F1 DNA During 2015
sa15967 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26397
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082536 Essential Splice Site 412 795 13 23
ENSDART00000134379 Essential Splice Site 492 1614 15 35
Genomic Location:
Chromosome 5 (position 7722057)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGCAAAACCTGGACTGGAACTGGATTTTGATCATCACTATACTGAAG[G/A]TAAAAACCCACATTTAGTTATAAACAAATGTAATTTTATGTTTAGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15967
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082536 Nonsense 614 795 18 23
ENSDART00000134379 Nonsense 693 1614 20 35
Genomic Location:
Chromosome 5 (position 7733726)
KASP Assay ID:
2259-5398.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCCAATGTTGAGTTCTTCAGTAACTGGGGGATGGAGCTGCTGGTCACG[C/T]AGTTGCACGACCACAAYAAAACCATCTCAATGGAGGCGCTCGAYATTCKG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xr7y9y04