rictora

Ensembl ID:
ENSDARG00000059414
ZFIN ID:
ZDB-GENE-060526-49
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2CE46]
Human Orthologue:
RICTOR
Human Description:
RPTOR independent companion of MTOR, complex 2 [Source:HGNC Symbol;Acc:28611]
Mouse Orthologue:
Rictor
Mouse Description:
RPTOR independent companion of MTOR, complex 2 Gene [Source:MGI Symbol;Acc:MGI:1926007]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15967 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15967
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082536 Nonsense 614 795 18 23
ENSDART00000134379 Nonsense 693 1614 20 35
Genomic Location:
Chromosome 5 (position 7733726)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCCAATGTTGAGTTCTTCAGTAACTGGGGGATGGAGCTGCTGGTCACG[C/T]AGTTGCACGACCACAAYAAAACCATCTCAATGGAGGCGCTCGAYATTCKG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xr7y9y04