ENSDARG00000059409

Ensembl ID:
ENSDARG00000059409
Human Orthologues:
ABCD2, AC138915.1
Human Description:
ATP-binding cassette, sub-family D (ALD), member 2 [Source:HGNC Symbol;Acc:66]
Mouse Orthologue:
Abcd2
Mouse Description:
ATP-binding cassette, sub-family D (ALD), member 2 Gene [Source:MGI Symbol;Acc:MGI:1349467]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39076 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39076
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082522 Nonsense 245 509 1 4
Genomic Location (Zv9):
Chromosome 16 (position 3814002)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 2971914
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTCACTAAGCCCATCCTGGACGTGATTCTGACTTCGTACACGTTGATA[C/T]AGACGGCGCGGTCCCGGGGGGCGAACGCGAGCGGGCCCACGCTGCTGGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link