myef2

Ensembl ID:
ENSDARG00000059398
ZFIN ID:
ZDB-GENE-051120-114
Description:
myelin expression factor 2 isoform 2 [Source:RefSeq peptide;Acc:NP_001025455]
Human Orthologue:
MYEF2
Human Description:
myelin expression factor 2 [Source:HGNC Symbol;Acc:17940]
Mouse Orthologues:
Gm9833, Myef2
Mouse Descriptions:
myelin basic protein expression factor 2, repressor Gene [Source:MGI Symbol;Acc:MGI:104592]
predicted gene 9833 Gene [Source:MGI Symbol;Acc:MGI:3641855]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15988 Nonsense Available for shipment Available now
sa36558 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15988
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082504 Nonsense 281 553 8 17
ENSDART00000082506 Nonsense 281 557 8 18
ENSDART00000097960   None 327 None 10
ENSDART00000123823 Nonsense 281 557 7 16

The following transcripts of ENSDARG00000059398 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 4672222)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 5560053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTGACTCGGTGCTCAGCAATGTTCAACGGTCAGATGCTGTTCGACAGA[C/T]AGATGCAYGTRAAGATGGTGAGATGTTACACATGTTATTGAGCAGCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082504 Nonsense 494 553 16 17
ENSDART00000082506 Nonsense 498 557 17 18
ENSDART00000097960 Nonsense 268 327 9 10
ENSDART00000123823 Nonsense 498 557 15 16

The following transcripts of ENSDARG00000059398 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 4665626)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 5553457
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTTGTGTCCGCAGCTCTCCTATGATCTGAGCTGGCAAAAGCTGAAG[G/T]AGAAGTTCAGTCACTGCGGTAAGTGTGTATATTGCTGTAATCAAATGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link