tas1r2.2

Ensembl ID:
ENSDARG00000059397
ZFIN ID:
ZDB-GENE-070917-2
Description:
taste receptor, type 1, member 2.2 [Source:RefSeq peptide;Acc:NP_001077325]
Human Orthologue:
TAS1R2
Human Description:
taste receptor, type 1, member 2 [Source:HGNC Symbol;Acc:14905]
Mouse Orthologue:
Tas1r2
Mouse Description:
taste receptor, type 1, member 2 Gene [Source:MGI Symbol;Acc:MGI:1933546]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21380 Nonsense Mutation detected in F1 DNA During 2014
sa21379 Nonsense Mutation detected in F1 DNA During 2014
sa21378 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21380
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082509 Nonsense 261 823 3 6
Genomic Location:
Chromosome 8 (position 48820044)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGATTGATATGCTTAACGTCAATGTCATCGTTGTTTTTGCTGAACAG[C/T]AGTATGCCAGCAACATTATCAAAGCAGCGATAGCAAACGACGTTCGTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21379
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082509 Nonsense 310 823 3 6
Genomic Location:
Chromosome 8 (position 48819897)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGGGAGCCAGGGATTGAGAAAATCGGTACAGTCATTGGCATTACAGAG[C/T]GATTCTTGTCGTTACCTGGATTCAATGAATTCATCTATAAAGAAAGGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21378
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082509 Essential Splice Site 473 823 5 6
Genomic Location:
Chromosome 8 (position 48818553)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTATCCGACTTGTTTTGATGTTAACCTCATATTTTTTCATTCCACAA[A/C]GGTTCCTTTCTCAAACTGTTCTGCTGAGTGCAAGGAAGGATTTGCAAGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Parkinson's disease: Genome-wide association study confirms SNPs in SNCA and the MAPT region as common risk factors for Parkinson disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qrcvw1n2