bdh1

Ensembl ID:
ENSDARG00000059388
ZFIN ID:
ZDB-GENE-070410-130
Description:
D-beta-hydroxybutyrate dehydrogenase, mitochondrial [Source:RefSeq peptide;Acc:NP_001082978]
Human Orthologue:
BDH1
Human Description:
3-hydroxybutyrate dehydrogenase, type 1 [Source:HGNC Symbol;Acc:1027]
Mouse Orthologue:
Bdh1
Mouse Description:
3-hydroxybutyrate dehydrogenase, type 1 Gene [Source:MGI Symbol;Acc:MGI:1919161]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15268 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15268
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082499 Nonsense 233 359 5 5
ENSDART00000147468 Nonsense 237 363 5 5
Genomic Location:
Chromosome 24 (position 3413626)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATGGGAAACGCTCTCCGCTCGCCGTACTGTATTTCCAAATACGGAGTT[G/T]AAGCTTTTTCAGACTGTCTGCGATAYGAAATGAAGACGTGGGGCGTCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1va5joc9