gria4b

Ensembl ID:
ENSDARG00000059368
ZFIN ID:
ZDB-GENE-030131-8013
Description:
glutamate receptor, ionotropic, AMPA 4b [Source:RefSeq peptide;Acc:NP_997917]
Human Orthologue:
GRIA4
Human Description:
glutamate receptor, ionotrophic, AMPA 4 [Source:HGNC Symbol;Acc:4574]
Mouse Orthologue:
Gria4
Mouse Description:
glutamate receptor, ionotropic, AMPA4 (alpha 4) Gene [Source:MGI Symbol;Acc:MGI:95811]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3112 Nonsense F2 line generated During 2014
sa13954 Essential Splice Site Available for shipment Available now
sa23921 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23922 Nonsense Mutation detected in F1 DNA During 2014
sa4949 Nonsense Mutation detected in F1 DNA During 2014
sa8999 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3112
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016916 Nonsense 158 904 3 16

The following transcripts of ENSDARG00000059368 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 20948715)
KASP Assay ID:
554-2544.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTCAGCCTGCTGGACCACTATGACTGGAATCGCTTTGTCTTTCTCTA[C/A]GACACCGACAGGGGTAAGACAATTAAACACCCACTCATAATAATGCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13954
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016916 Essential Splice Site 163 904 3 16

The following transcripts of ENSDARG00000059368 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 20948730)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCACTATGACTGGAATCGCTTTGTCTTTCTCTAMGACACCGACAGGGG[T/A]AAGACAATTAAACACCMACTCATAATAATGCACAGTTCACTTTGCTGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23921
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016916 Essential Splice Site 295 904 6 16

The following transcripts of ENSDARG00000059368 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 20967718)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACAAGCTGGACCAGCGCGAGTACCCCGGCTCTGACGCACCTCCCAAGG[T/G]AACGTTGCATGGCTTGGTCCAGCGCACAACCGCTTTGAAGCCTGATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23922
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016916 Nonsense 438 904 10 16

The following transcripts of ENSDARG00000059368 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 20996511)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTTAGGAAGGGCCGTATGTAATGCTGAAGAAAAACTGGGAAATGTAC[G/T]AGGGGAATGAGCAATATGAGGGATACTGTGTGGATTTGGCATCTGAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4949
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016916 Nonsense 462 904 10 16

The following transcripts of ENSDARG00000059368 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 20996585)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTGTGTGGATTTGGCATCTGAAATTGCCAAACACATCGGTTTCAAGTA[T/A]AAGATCTCCATCGTGCCTGATGGAAAGTACGGAGCTCGAGACCCAGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8999
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016916 Nonsense 612 904 11 16

The following transcripts of ENSDARG00000059368 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 21000251)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTTCAACAGTCTCTGGTTCTCACTCGGTGCCTTCATGCAGCAGGGGTG[C/A]GACATCTCGCCCAGGTAAGCCGACTCTTCTTGCGAGTAAAAACATTGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dtn1q1do