TGFBR2 (2 of 2)

Ensembl ID:
ENSDARG00000059363
Description:
transforming growth factor, beta receptor II (70/80kDa) [Source:HGNC Symbol;Acc:11773]
Human Orthologue:
TGFBR2
Human Description:
transforming growth factor, beta receptor II (70/80kDa) [Source:HGNC Symbol;Acc:11773]
Mouse Orthologue:
Tgfbr2
Mouse Description:
transforming growth factor, beta receptor II Gene [Source:MGI Symbol;Acc:MGI:98729]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23405 Nonsense Mutation detected in F1 DNA During 2014
sa12495 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23405
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082466 Nonsense 32 659 2 10
Genomic Location:
Chromosome 19 (position 953757)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCTGGTGTTTCTGCAGCTCTTCTCCGCACTGCTGATCTCCGCATCTG[C/A]AGCTCCTGTAAGCCTCATCCAGTCAACTGTGTGTCAAATCAGTGCTTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12495
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082466 Nonsense 352 659 6 10
Genomic Location:
Chromosome 19 (position 961047)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAACACTGAGCTGCTGCCCATCCAGCTGGACAGAGTTGTGGGAAAAGGA[C/T]GAWTCGCAGACGTTTATAAAGCCAAGCTGAAGCAGAGCGCAGACTCCTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Migraine: Genome-wide association analysis identifies susceptibility loci for migraine without aura. (View Study)
  • Tonometry: Framingham Heart Study 100K Project: genome-wide associations for blood pressure and arterial stiffness. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v0e0ncmu