hnrnpa3

Ensembl ID:
ENSDARG00000059351
ZFIN ID:
ZDB-GENE-060224-1
Description:
heterogeneous nuclear ribonucleoprotein A3 [Source:RefSeq peptide;Acc:NP_001038904]
Human Orthologue:
HNRNPA3
Human Description:
heterogeneous nuclear ribonucleoprotein A3 [Source:HGNC Symbol;Acc:24941]
Mouse Orthologues:
AC114648.1, Gm7551, Gm8991, Hnrnpa3
Mouse Descriptions:
heterogeneous nuclear ribonucleoprotein A3 Gene [Source:MGI Symbol;Acc:MGI:1917171]
predicted gene 6793 (Gm6793), non-coding RNA [Source:RefSeq DNA;Acc:NR_033513]
predicted gene 7551 Pseudogene [Source:MGI Symbol;Acc:MGI:3648704]
predicted pseudogene 8991 Pseudogene [Source:MGI Symbol;Acc:MGI:3644227]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16864 Nonsense Available for shipment Available now
sa7170 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16864
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102934 Nonsense 140 234 4 8
ENSDART00000135273 Nonsense 140 312 4 11
ENSDART00000137210 Nonsense 140 234 4 8
ENSDART00000144822 Nonsense 140 241 4 8
Genomic Location:
Chromosome 9 (position 1687746)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGAGTGCTACGGCAAGATTGAGACCATYGATATCATGGAGGAGCGCT[C/A]GACTGGGAAGAAGAGAGGATTCTGCTTCGTCACCTTCGACGATCACGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7170
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102934 None 215 234 7 8
ENSDART00000135273 Essential Splice Site 245 312 None 11
ENSDART00000137210 Essential Splice Site 215 234 None 8
ENSDART00000144822 None None 241 None 8
Genomic Location:
Chromosome 9 (position 1684656)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTATGGTGGTGGTCCTGGTGGATATGGAGGCGGCCGCGGAGGATACGG[T/C]GGAGGTCCAGGATATGGCAACCAGGGAGGTGGAGGAGGCTTYGGTGGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/iuakhphk