hnrnpa3

Ensembl ID:
ENSDARG00000059351
ZFIN ID:
ZDB-GENE-060224-1
Description:
heterogeneous nuclear ribonucleoprotein A3 [Source:RefSeq peptide;Acc:NP_001038904]
Human Orthologue:
HNRNPA3
Human Description:
heterogeneous nuclear ribonucleoprotein A3 [Source:HGNC Symbol;Acc:24941]
Mouse Orthologues:
AC114648.1, Gm7551, Gm8991, Hnrnpa3
Mouse Descriptions:
heterogeneous nuclear ribonucleoprotein A3 Gene [Source:MGI Symbol;Acc:MGI:1917171]
predicted gene 6793 (Gm6793), non-coding RNA [Source:RefSeq DNA;Acc:NR_033513]
predicted gene 7551 Pseudogene [Source:MGI Symbol;Acc:MGI:3648704]
predicted pseudogene 8991 Pseudogene [Source:MGI Symbol;Acc:MGI:3644227]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16864 Nonsense Available for shipment Available now
sa7170 Essential Splice Site Mutation detected in F1 DNA During 2015
sa27318 Splice Site, Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa16864
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102934 Nonsense 140 234 4 8
ENSDART00000135273 Nonsense 140 312 4 11
ENSDART00000137210 Nonsense 140 234 4 8
ENSDART00000144822 Nonsense 140 241 4 8
Genomic Location:
Chromosome 9 (position 1687746)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGAGTGCTACGGCAAGATTGAGACCATYGATATCATGGAGGAGCGCT[C/A]GACTGGGAAGAAGAGAGGATTCTGCTTCGTCACCTTCGACGATCACGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7170
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102934   215 234 7 8
ENSDART00000135273 Essential Splice Site 245 312 None 11
ENSDART00000137210 Essential Splice Site 215 234 None 8
ENSDART00000144822   None 241 None 8
Genomic Location:
Chromosome 9 (position 1684656)
KASP Assay ID:
554-4671.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTATGGTGGTGGTCCTGGTGGATATGGAGGCGGCCGCGGAGGATACGG[T/C]GGAGGTCCAGGATATGGCAACCAGGGAGGTGGAGGAGGCTTYGGTGGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27318
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102934 Splice Site None 234 None 8
ENSDART00000135273 Nonsense 296 312 10 11
ENSDART00000137210 Nonsense 218 234 8 8
ENSDART00000144822   None 241 None 8
Genomic Location:
Chromosome 9 (position 1682933)
KASP Assay ID:
2260-1366.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTAACACTCAATCCTGATCATTGTCATTGCTCTGATAGGTGGAGGATA[C/A]GGCTCTGGTGGCGGAGGCGGAGGCGGAGGTTACGGCTCCAGGAGATATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/iuakhphk