HOMER2

Ensembl ID:
ENSDARG00000059349
Description:
homer homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:17513]
Human Orthologue:
HOMER2
Human Description:
homer homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:17513]
Mouse Orthologue:
Homer2
Mouse Description:
homer homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1347354]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5905 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11712 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5905
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082450 None None 175 None 5
ENSDART00000124088 Essential Splice Site 78 271 4 12
Genomic Location:
Chromosome 18 (position 841)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTAATATTAGCGAGCTGCATGTSACTCATGTATTGAAGAGTGTTTACA[G/A]TTTTCATTGCGTACGCTGCGGCATCACGAGCGAGAGAAATGCAGCATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11712
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082450 None None 175 None 5
ENSDART00000124088 Nonsense 87 271 4 12
Genomic Location:
Chromosome 18 (position 868)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGTATTGAAGAGWKTTTACARTTTTCATTGCGTACGCTGCGGCATCA[C/T]GAGCGAGAGAAATGCAGCATRAACAATACAAGCATWTYCATTAAACATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vpluxfkn