HOMER2

Ensembl ID:
ENSDARG00000059349
Description:
homer homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:17513]
Human Orthologue:
HOMER2
Human Description:
homer homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:17513]
Mouse Orthologue:
Homer2
Mouse Description:
homer homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1347354]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36549 Nonsense Mutation detected in F1 DNA During 2016
sa5905 Essential Splice Site Mutation detected in F1 DNA During 2016
sa11712 Nonsense Available for shipment Available now
sa32179 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36549
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082450   None 175 None 5
ENSDART00000124088 Nonsense 41 271 2 12
Genomic Location (Zv9):
Chromosome 18 (position 253)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 253
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACACACACACACACACACACACAGCGCTGTGAGGATCTTCCTCTGCA[C/T]AGGGTTTATGGTTCATGTTGCCATGGAGATTTGGATCAGTCCCTCAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5905
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082450   None 175 None 5
ENSDART00000124088 Essential Splice Site 78 271 4 12
Genomic Location (Zv9):
Chromosome 18 (position 841)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 841
KASP Assay ID:
554-3739.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTAATATTAGCGAGCTGCATGTSACTCATGTATTGAAGAGTGTTTACA[G/A]TTTTCATTGCGTACGCTGCGGCATCACGAGCGAGAGAAATGCAGCATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11712
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082450   None 175 None 5
ENSDART00000124088 Nonsense 87 271 4 12
Genomic Location (Zv9):
Chromosome 18 (position 868)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 868
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGTATTGAAGAGWKTTTACARTTTTCATTGCGTACGCTGCGGCATCA[C/T]GAGCGAGAGAAATGCAGCATRAACAATACAAGCATWTYCATTAAACATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32179
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082450 Essential Splice Site 86 175 2 5
ENSDART00000124088   None 271 None 12
Genomic Location (Zv9):
Chromosome 18 (position 2013)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACGGTCCGAATTCAAGAGTTGGAAGCAGATCTGCAGGACAAACAACAG[G/T]TGACACACACACACACGCACACACACACACACTTTCTCTCTGTGCTCCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link