calml4

Ensembl ID:
ENSDARG00000059347
ZFIN ID:
ZDB-GENE-071009-6
Human Orthologue:
CALML4
Human Description:
calmodulin-like 4 [Source:HGNC Symbol;Acc:18445]
Mouse Orthologue:
Calml4
Mouse Description:
calmodulin-like 4 Gene [Source:MGI Symbol;Acc:MGI:1922850]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37975 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30175 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37975
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082447 Essential Splice Site 11 155 1 5
Genomic Location (Zv9):
Chromosome 25 (position 1389363)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 1242943
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTCTTATGTTCTTACAGGCGAAATTCCTCAGTCAAGATCAAATCAACG[G/A]TAAGCAGGTCTCTGCATTATAACGTCTCTTATAGATATTGTGTAAATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30175
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082447 Essential Splice Site 12 155 1 5
Genomic Location (Zv9):
Chromosome 25 (position 1389364)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 1242942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTTATGTTCTTACAGGCGAAATTCCTCAGTCAAGATCAAATCAACGG[T/G]AAGCAGGTCTCTGCATTATAACGTCTCTTATAGATATTGTGTAAATATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link