LOC557621

Ensembl ID:
ENSDARG00000059340
Human Orthologue:
DLGAP2
Human Description:
discs, large (Drosophila) homolog-associated protein 2 [Source:HGNC Symbol;Acc:2906]
Mouse Orthologue:
Dlgap2
Mouse Description:
discs, large (Drosophila) homolog-associated protein 2 Gene [Source:MGI Symbol;Acc:MGI:2443181]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa249 Nonsense F2 line generated During 2014
sa23084 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa249
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082438 Nonsense 352 1100 3 15
Genomic Location:
Chromosome 17 (position 24933174)
KASP Assay ID:
554-2609.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTCACTAAAGACCTCTAAGAGCAACAATGACGTGAAATGTTCAGCATG[C/A]GAGAGCATCGCTATGGCCCCCGAGGGCAAATTCATGAAGCGCAGCTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23084
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082438 Essential Splice Site 692 1100 9 15
Genomic Location:
Chromosome 17 (position 24984010)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTACAGAGTCCACGCAGGATGCCTACCATGAGGGACAGCTGGCCAGAG[G/A]TCTGTTAACCACAGTTGTCTGAGTACTTTTCTAAACTTTTATAGTATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/69evohbu