si:ch211-285f17.1

Ensembl ID:
ENSDARG00000059333
ZFIN ID:
ZDB-GENE-000607-77
Human Orthologue:
KIAA1217
Human Description:
KIAA1217 [Source:HGNC Symbol;Acc:25428]
Mouse Orthologue:
Etl4
Mouse Description:
enhancer trap locus 4 Gene [Source:MGI Symbol;Acc:MGI:95454]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44090 Nonsense Mutation detected in F1 DNA During 2017
sa44091 Essential Splice Site Mutation detected in F1 DNA During 2017
sa17839 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44090
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082422 Nonsense 206 1306 4 19
ENSDART00000132688   None 57 None 3
ENSDART00000132724   None 959 None 17
Genomic Location (Zv9):
Chromosome 24 (position 9343941)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9402825
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCCACAATGCCACGTGAGCGAGCCGGACACACACTCCCAGCCCCTGCC[C/T]GAGCATCCTCCCCCTGCCCGAGTGCCATCTTGGAGCGGCGGGATGTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44091
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082422 Essential Splice Site 377 1306 None 19
ENSDART00000132688   None 57 None 3
ENSDART00000132724 Essential Splice Site 312 959 None 17
Genomic Location (Zv9):
Chromosome 24 (position 9344457)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9403341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTCAGGTTCACAATCCTCTGGCGCCCCCGACAGACCCTCAAACACGG[T/C]AAGTTCATTTATTCAGGAGCAAACTGGGCTTTCCAAGCATGAAAATAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17839
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082422 Nonsense 729 1306 11 19
ENSDART00000132688   None 57 None 3
ENSDART00000132724 Nonsense 629 959 13 17
Genomic Location (Zv9):
Chromosome 24 (position 9373887)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9432771
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCTACACAAAGAAGAGAGTCTACACCGTCACCCACTAAACAGCTCAGR[A/T]AACCCTCACTGGANNNNNNACAAACACAAAACAACACCAGTAATGGAGTYTCTGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link