LOC572502

Ensembl ID:
ENSDARG00000059329
Human Orthologue:
WDR7
Human Description:
WD repeat domain 7 [Source:HGNC Symbol;Acc:13490]
Mouse Orthologue:
Wdr7
Mouse Description:
WD repeat domain 7 Gene [Source:MGI Symbol;Acc:MGI:1860197]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10032 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10032
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102743 Nonsense 440 605 10 12
Genomic Location:
Chromosome 21 (position 2953933)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAYTGGTGTGYGGACGAGAGGACGGCAGCATCATACTGGTYCCTGCCACA[C/T]AGACGGCCATCGTCCAGCTGCTGCAGGGGGAACACATGCTGCGCCGCGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/umasklis