rpn1

Ensembl ID:
ENSDARG00000059323
ZFIN ID:
ZDB-GENE-030131-4286
Description:
dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 1 [Source:RefSeq peptide;Acc
Human Orthologue:
RPN1
Human Description:
ribophorin I [Source:HGNC Symbol;Acc:10381]
Mouse Orthologue:
Rpn1
Mouse Description:
ribophorin I Gene [Source:MGI Symbol;Acc:MGI:98084]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9566 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9566
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082404 Nonsense 283 547 5 10
ENSDART00000082409 Nonsense 334 598 5 10
ENSDART00000131100 Nonsense 283 547 4 9
ENSDART00000134858 Nonsense 132 396 2 7
Genomic Location:
Chromosome 11 (position 3963418)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACCCATTACATCATTGGTTATAATCTTCCCAGCTACGAATACCTCTA[C/A]AATCTAGGTGGGTGCCCGATTCGTAACCATCGTCACAGATTAGTGGGGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/armvk98f