golt1b

Ensembl ID:
ENSDARG00000059308
ZFIN ID:
ZDB-GENE-050913-94
Description:
Golgi transport 1 homolog B [Source:RefSeq peptide;Acc:NP_001026841]
Human Orthologue:
GOLT1B
Human Description:
golgi transport 1B [Source:HGNC Symbol;Acc:20175]
Mouse Orthologue:
Golt1b
Mouse Description:
golgi transport 1 homolog B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1914214]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44215 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44215
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082385 Essential Splice Site 9 138 1 5
Genomic Location (Zv9):
Chromosome 25 (position 3403152)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3221347
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCAGCTGATTAACGACACAATCATGATTTCATTAACGGACTCGCAGAG[T/A]AAGTCAGATGTTGTGTATTTTTACATTACGTTAATGATGTTAGTTTAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link