
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
golt1b
- Ensembl ID:
- ENSDARG00000059308
- ZFIN ID:
- ZDB-GENE-050913-94
- Description:
- Golgi transport 1 homolog B [Source:RefSeq peptide;Acc:NP_001026841]
- Human Orthologue:
- GOLT1B
- Human Description:
- golgi transport 1B [Source:HGNC Symbol;Acc:20175]
- Mouse Orthologue:
- Golt1b
- Mouse Description:
- golgi transport 1 homolog B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1914214]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa44215 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa44215
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082385 | Essential Splice Site | 9 | 138 | 1 | 5 |
- Genomic Location (Zv9):
- Chromosome 25 (position 3403152)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 3221347 GRCz11 25 3347091 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGCAGCTGATTAACGACACAATCATGATTTCATTAACGGACTCGCAGAG[T/A]AAGTCAGATGTTGTGTATTTTTACATTACGTTAATGATGTTAGTTTAAGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: