hnrnpl2

Ensembl ID:
ENSDARG00000059303
ZFIN ID:
ZDB-GENE-040426-2707
Description:
heterogeneous nuclear ribonucleoprotein L2 [Source:RefSeq peptide;Acc:NP_998548]
Human Orthologues:
AC027139.1, HNRNPL
Human Description:
heterogeneous nuclear ribonucleoprotein L [Source:HGNC Symbol;Acc:5045]
Mouse Orthologue:
Hnrnpl
Mouse Description:
heterogeneous nuclear ribonucleoprotein L Gene [Source:MGI Symbol;Acc:MGI:104816]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22584 Essential Splice Site Available for shipment Available now
sa8434 Nonsense Mutation detected in F1 DNA During 2017
sa28401 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22584
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051180 Essential Splice Site 234 481 None 13
ENSDART00000102471 Essential Splice Site 234 499 None 12
ENSDART00000142334 Essential Splice Site 234 522 None 13

The following transcripts of ENSDARG00000059303 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 5689153)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5807490
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGACCAGGACACATGGGACTACACCAATCCGAGCCTGGGCACTCAAGG[T/G]ACTGTTAACCTTACTTCTGCTTTAGCATTTGTCAGCGCCCTTACTGCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8434
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051180 Nonsense 250 481 7 13
ENSDART00000102471 Nonsense 250 499 7 12
ENSDART00000142334 Nonsense 273 522 8 13

The following transcripts of ENSDARG00000059303 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 5684705)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5803042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGTGGTTATCCCGGGTACCCAGATGAGAGCTATGGCTATGAGGGYCGA[C/T]GAATGGGACCTCCTATGAGTGCTCCAAGGCGAGGTGGAGCCAGCCAGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28401
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051180 Splice Site None 481 None 13
ENSDART00000102471 Nonsense 260 499 7 12
ENSDART00000142334 Nonsense 283 522 8 13

The following transcripts of ENSDARG00000059303 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 5684675)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5803012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTATGGCTATGAGGGTCGACGAATGGGACCTCCTATGAGTGCTCCAAGG[C/T]GAGGTGGAGCCAGCCAGCGCTACAGCGCACAGTATGGTGGTCCTCCACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link