LOC571584

Ensembl ID:
ENSDARG00000059294
Human Orthologue:
MARCO
Human Description:
macrophage receptor with collagenous structure [Source:HGNC Symbol;Acc:6895]
Mouse Orthologue:
Marco
Mouse Description:
macrophage receptor with collagenous structure Gene [Source:MGI Symbol;Acc:MGI:1309998]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16897 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16897
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082368 Essential Splice Site 345 388 16 17
Genomic Location:
Chromosome 9 (position 784021)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGAATGCTGGGCTTCCAGAGATCCACRCAGGTCTACACTGACGGTTCAG[G/A]TGACGTCTTTGTCTATGGRTTWAGTTCATGGTWTGGGGGTTAGTAAAGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9glp5av9