lck

Ensembl ID:
ENSDARG00000059282
ZFIN IDs:
ZDB-GENE-040617-1, ZDB-GENE-040617-1, ZDB-GENE-040617-1
Description:
lymphocyte-specific protein tyrosine kinase isoform 2 [Source:RefSeq peptide;Acc:NP_001035418]
Human Orthologue:
LCK
Human Description:
lymphocyte-specific protein tyrosine kinase [Source:HGNC Symbol;Acc:6524]
Mouse Orthologue:
Lck
Mouse Description:
lymphocyte protein tyrosine kinase Gene [Source:MGI Symbol;Acc:MGI:96756]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa410 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa410
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082356 Nonsense 120 503 5 12
ENSDART00000105478 Nonsense 120 503 6 13
ENSDART00000126663 Nonsense 120 503 6 13
Genomic Location:
Chromosome 17 (position 25162106)
KASP Assay ID:
554-0269.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAAATGAAGTGAAAACTCTAATAAAATGACATCGTTGTGTTGCAGGTG[G/A]TTCTATAAAAATCTCTCCAGGAATGACGCCATGAGGCAGTTACTGGCTCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nyboc294