hoxd3a

Ensembl ID:
ENSDARG00000059280
ZFIN ID:
ZDB-GENE-990415-120
Description:
Homeobox protein Hox-D3a [Source:UniProtKB/Swiss-Prot;Acc:O42370]
Human Orthologue:
HOXD3
Human Description:
homeobox D3 [Source:HGNC Symbol;Acc:5137]
Mouse Orthologue:
Hoxd3
Mouse Description:
homeobox D3 Gene [Source:MGI Symbol;Acc:MGI:96207]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38720 Nonsense Mutation detected in F1 DNA During 2017
sa21417 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38720
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082359 Nonsense 14 403 1 2
ENSDART00000146131 Nonsense 14 396 1 2

The following transcripts of ENSDARG00000059280 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 1929850)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1938254
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACCTTCGCAATGCAGAAAGCCACTTATTATGACAATGCTGGACTTTTC[G/T]GAGGATATTCGTACCCTAAATCTGACTCCTACACGTACGGTCCAACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21417
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082359 Essential Splice Site 147 403 1 2
ENSDART00000146131 Essential Splice Site 147 396 1 2

The following transcripts of ENSDARG00000059280 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 1929447)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1937851
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGACCCGCCAAAATGCAAAGCAGAAAAGCACCAACTGCCCAGCAGCAG[G/A]TATGGGCTTTGCTTGAGTGAGTGTGTGTGCGCGGCTGGAGAGAATAGTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ovarian cancer: A genome-wide association study identifies susceptibility loci for ovarian cancer at 2q31 and 8q24. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link