tfap2a

Ensembl ID:
ENSDARG00000059279
ZFIN IDs:
ZDB-GENE-011212-6, ZDB-GENE-011212-6, ZDB-GENE-011212-6
Description:
transcription factor AP-2-alpha [Source:RefSeq peptide;Acc:NP_789829]
Human Orthologue:
TFAP2A
Human Description:
transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) [Source:HGNC Symbol;Ac
Mouse Orthologue:
Tcfap2a
Mouse Description:
transcription factor AP-2, alpha Gene [Source:MGI Symbol;Acc:MGI:104671]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24445 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24445
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082346 Nonsense 224 425 4 7
ENSDART00000082349 Nonsense 230 431 4 7
ENSDART00000082351 Nonsense 236 437 4 7
Genomic Location:
Chromosome 24 (position 8525292)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTCTCAGCTCAACGTCAAAGTACAAAGTCACAGTAGCGGAGGTGCAG[A/T]GACGTCTTTCTCCGCCTGAGTGCCTGAACGCTTCCTTGCTCGGCGGCGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vrdlxh5r