hoxd4a

Ensembl ID:
ENSDARG00000059276
ZFIN ID:
ZDB-GENE-980526-214
Description:
Homeobox protein Hox-D4a [Source:UniProtKB/Swiss-Prot;Acc:O57374]
Human Orthologue:
HOXD4
Human Description:
homeobox D4 [Source:HGNC Symbol;Acc:5138]
Mouse Orthologue:
Hoxd4
Mouse Description:
homeobox D4 Gene [Source:MGI Symbol;Acc:MGI:96208]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31696 Nonsense Available for shipment Available now
sa30912 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31696
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082355 Nonsense 52 256 1 2
Genomic Location (Zv9):
Chromosome 9 (position 1941422)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1949826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAATTTCCTCCTTGCGAGGAATATTCTCAGAACAGCTATATACCTGAA[C/T]AGAGCCCAGGCTACTACAGTCCGTCGCAGGACACTGATTTCCAGCATCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30912
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082355 Nonsense 215 256 2 2
Genomic Location (Zv9):
Chromosome 9 (position 1940541)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1948945
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCGCGCACACACTCTGTCTTTCTGAAAGACAGATTAAAATCTGGTTT[C/T]AGAACAGGAGAATGAAATGGAAAAAGGATCACAAACTACCAAACACGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link