LOC557467

Ensembl ID:
ENSDARG00000059272
Human Orthologue:
KBTBD11
Human Description:
kelch repeat and BTB (POZ) domain containing 11 [Source:HGNC Symbol;Acc:29104]
Mouse Orthologue:
Kbtbd11
Mouse Description:
kelch repeat and BTB (POZ) domain containing 11 Gene [Source:MGI Symbol;Acc:MGI:1922151]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15491 Nonsense Available for shipment Available now
sa8879 Nonsense Mutation detected in F1 DNA During 2014
sa12654 Nonsense Available for shipment Available now
sa12661 Nonsense Available for shipment Available now
sa4007 Nonsense Mutation detected in F1 DNA During 2014
sa2926 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa15491
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082352 Nonsense 33 468 1 2
Genomic Location:
Chromosome 17 (position 27193396)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYAAATCAGTATTAGCTGARAAGAGCGATTAYTTTAAGGCCAGGCTTTCT[C/T]GAGACATCCTCAMAGTAAAAGGAATGAGCTACAAGACCTTATCAGTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8879
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082352 Nonsense 98 468 1 2
Genomic Location:
Chromosome 17 (position 27193593)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGCWGCTATTGATACYATTTCCACACAGATCACACCTGAGAACTGCTA[C/A]GAAATCCTAACGATYGCTAAAAAGCAACGATTAAATGAACTGAAAGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12654
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082352 Nonsense 118 468 1 2
ENSDART00000082352 Nonsense 118 468 1 2
Genomic Location:
Chromosome 17 (position 27193651)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACGATYGCTAAAAAGCAACGATTAAATGAACTGAAAGAAACCRCCTAT[C/T]GATTCATGAGTGACAACTTTCTGCAGGTTCTRAAAGATCCAGCTGTCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12661
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082352 Nonsense 118 468 1 2
ENSDART00000082352 Nonsense 118 468 1 2
Genomic Location:
Chromosome 17 (position 27193651)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACGATYGCTAAAAAGCAACGATTAAATGAACTGAAAGAAACCRCCTAT[C/T]GATTCATGAGTGACAACTTTCTGCAGGTTCTRAAAGATCCAGCTGTCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4007
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082352 Nonsense 258 468 1 2
Genomic Location:
Chromosome 17 (position 27194073)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAAAGTCTCAGACAGGGTTTACTGCTATAATCCTGTCACAGACCGCTG[G/A]AGTGAAGTTAGACCCAYGAACCAAGCCCGATCACAACTCAAACTCGTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2926
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082352 Nonsense 334 468 1 2
Genomic Location:
Chromosome 17 (position 27194301)
KASP Assay ID:
554-3293.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCACTACATGTAACGGCGAGCTGTATGTCTCTGGAGGATCTCTGTTCTA[T/A]CGGTTGCTAAAATATGACCCTAAGAGGGACGAATGGCAGGAGTGTCCGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7lb2yvk9