PRTG (1 of 2)

Ensembl ID:
ENSDARG00000059269
Description:
protogenin [Source:HGNC Symbol;Acc:26373]
Human Orthologue:
PRTG
Human Description:
protogenin [Source:HGNC Symbol;Acc:26373]
Mouse Orthologue:
Prtg
Mouse Description:
protogenin homolog (Gallus gallus) Gene [Source:MGI Symbol;Acc:MGI:2444710]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28211 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42311 Essential Splice Site Mutation detected in F1 DNA During 2018
sa35610 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa28211
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082348 Essential Splice Site 20 1134 1 24
Genomic Location (Zv9):
Chromosome 13 (position 52216922)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 730517
GRCz11 18 619735
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAAAAGGGATTTATACCTGTTTCTTGCTGTATTTCTGTCAATCTCAGG[T/A]AAGAACGGCTATTTCAATTAAGTTGTGTGTGAACTTTTAGCCGGTTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42311
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082348 Essential Splice Site 605 1134 9 24
Genomic Location (Zv9):
Chromosome 13 (position 52239902)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150056.1 12337
GRCz11 KN150056.1 12337
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTCCGCCTGGAGCTCTCACAGGACACCCAAAGCCTCCAGTACTAAAGG[T/C]GGAGCATCTGCCTGTCTCTCTGTCTGCCCATGTATCTCAAATGGCACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35610
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082348 Nonsense 959 1134 22 24
Genomic Location (Zv9):
Chromosome 13 (position 52254977)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2853306
GRCz11 18 2139429
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATGACAGGAAATCCTGCACTACCAAATCCATCAGGCAGGCAGGAGGA[C/T]AGACTCCGCCCACTGCAGTCCGTCTGGCCAATGAGAGTGCAGCTGAGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link