hoxd12a

Ensembl ID:
ENSDARG00000059263
ZFIN ID:
ZDB-GENE-990415-118
Description:
Homeobox protein Hox-D12a [Source:UniProtKB/Swiss-Prot;Acc:Q90471]
Human Orthologue:
HOXD12
Human Description:
homeobox D12 [Source:HGNC Symbol;Acc:5135]
Mouse Orthologue:
Hoxd12
Mouse Description:
homeobox D12 Gene [Source:MGI Symbol;Acc:MGI:96204]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21419 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21419
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082339 Nonsense 254 277 2 2
ENSDART00000142842 Nonsense 239 262 3 3
Genomic Location (Zv9):
Chromosome 9 (position 1973206)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1981610
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAACGGAAGGAGCTTTCGGACAGATTGGAACTGAGTGATCAGCAAGTC[A/T]AAATCTGGTTTCAGAATCGCAGGATGAAGAAAAAGAGACTCATGATGCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link