hoxd13a

Ensembl ID:
ENSDARG00000059256
ZFIN ID:
ZDB-GENE-990415-119
Description:
Homeobox protein Hox-D13a [Source:UniProtKB/Swiss-Prot;Acc:Q90472]
Human Orthologue:
HOXD13
Human Description:
homeobox D13 [Source:HGNC Symbol;Acc:5136]
Mouse Orthologue:
Hoxd13
Mouse Description:
homeobox D13 Gene [Source:MGI Symbol;Acc:MGI:96205]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9140 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9140
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082332 Essential Splice Site 179 256 1 2
Genomic Location (Zv9):
Chromosome 9 (position 1980501)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1988905
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTYTCAAGACCAGACGCGGAGCCCGCATATCTGGAAACCATCATTAACAG[G/A]TAAGACCTCAGCTCTGCTTTGACTCACTCCTCGCCTCTCTTCATTAGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link