arfip2a

Ensembl ID:
ENSDARG00000059244
ZFIN ID:
ZDB-GENE-041010-221
Description:
ADP-ribosylation factor interacting protein 2a [Source:RefSeq peptide;Acc:NP_001005935]
Human Orthologue:
ARFIP2
Human Description:
ADP-ribosylation factor interacting protein 2 [Source:HGNC Symbol;Acc:17160]
Mouse Orthologue:
Arfip2
Mouse Description:
ADP-ribosylation factor interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1924182]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42581 Nonsense Mutation detected in F1 DNA During 2016
sa3928 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42582 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42581
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082315 Nonsense 205 391 7 10
ENSDART00000133867 Nonsense 117 303 3 6
Genomic Location:
Chromosome 15 (position 31505491)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTACGAGCGTATTTTGAGGCTTGCGCGTGAGCTCACCAACCATTTCTA[T/A]AACATGGTGCAGACTCAGCAGGCTCTCGGGGACACTTTTGCTGATCTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3928
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082315 Essential Splice Site 229 391 7 10
ENSDART00000133867 Essential Splice Site 141 303 3 6
Genomic Location:
Chromosome 15 (position 31505565)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCGGGGACACTTTTGCTGATCTTAGCCAGAAATCCCCAGAATTGCAGG[T/A]AATGTATAATTTTTTTCTGTCCTTGNTTCTTGCTGCAGATGTTAAGCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42582
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082315 Nonsense 314 391 9 10
ENSDART00000133867 Nonsense 226 303 5 6
Genomic Location:
Chromosome 15 (position 31512295)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGGTCCGCGGGATGCTGCAACCATGATGCGCATAGAGATAGCTCAACAA[C/T]AGTACCAGATTCAGAAAGACAAGTATGAACGGCTGCACAGTGATGTCACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link