arfip2a

Ensembl ID:
ENSDARG00000059244
ZFIN ID:
ZDB-GENE-041010-221
Description:
ADP-ribosylation factor interacting protein 2a [Source:RefSeq peptide;Acc:NP_001005935]
Human Orthologue:
ARFIP2
Human Description:
ADP-ribosylation factor interacting protein 2 [Source:HGNC Symbol;Acc:17160]
Mouse Orthologue:
Arfip2
Mouse Description:
ADP-ribosylation factor interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1924182]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3928 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3928
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082315 Essential Splice Site 229 391 7 10
ENSDART00000133867 Essential Splice Site 141 303 3 6
Genomic Location:
Chromosome 15 (position 31505565)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCGGGGACACTTTTGCTGATCTTAGCCAGAAATCCCCAGAATTGCAGG[T/A]AATGTATAATTTTTTTCTGTCCTTGNTTCTTGCTGCAGATGTTAAGCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ep97dr69