arfip2a

Ensembl ID:
ENSDARG00000059244
ZFIN ID:
ZDB-GENE-041010-221
Description:
ADP-ribosylation factor interacting protein 2a [Source:RefSeq peptide;Acc:NP_001005935]
Human Orthologue:
ARFIP2
Human Description:
ADP-ribosylation factor interacting protein 2 [Source:HGNC Symbol;Acc:17160]
Mouse Orthologue:
Arfip2
Mouse Description:
ADP-ribosylation factor interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1924182]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42581 Nonsense Mutation detected in F1 DNA During 2016
sa42582 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42581
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082315 Nonsense 205 391 7 10
ENSDART00000133867 Nonsense 117 303 3 6
Genomic Location (Zv9):
Chromosome 15 (position 31505491)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32401143
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTACGAGCGTATTTTGAGGCTTGCGCGTGAGCTCACCAACCATTTCTA[T/A]AACATGGTGCAGACTCAGCAGGCTCTCGGGGACACTTTTGCTGATCTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42582
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082315 Nonsense 314 391 9 10
ENSDART00000133867 Nonsense 226 303 5 6
Genomic Location (Zv9):
Chromosome 15 (position 31512295)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32407947
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGGTCCGCGGGATGCTGCAACCATGATGCGCATAGAGATAGCTCAACAA[C/T]AGTACCAGATTCAGAAAGACAAGTATGAACGGCTGCACAGTGATGTCACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link