rtn4b

Ensembl ID:
ENSDARG00000059238
ZFIN IDs:
ZDB-GENE-030710-2, ZDB-GENE-030710-2
Description:
reticulon 4b [Source:RefSeq peptide;Acc:NP_001035425]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa699 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa699
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006871 Nonsense 72 688 1 3
ENSDART00000082287 Nonsense 72 663 1 5
ENSDART00000082292 Nonsense 72 673 1 2
Genomic Location:
Chromosome 13 (position 69830)
KASP Assay ID:
554-0607.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATAACTGAGGTAAATACAGCTCCACAGACAGCTGAGGTAACTAGTGCT[G/T]AACAGATAACTGAGGTAACTAGTGCTGAACAGACTAGTTTAACACCGACA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n2i25lce