ptger4a

Ensembl ID:
ENSDARG00000059236
ZFIN ID:
ZDB-GENE-060222-1
Description:
prostaglandin E receptor 4 (subtype EP4) a [Source:RefSeq peptide;Acc:NP_001034718]
Human Orthologue:
PTGER4
Human Description:
prostaglandin E receptor 4 (subtype EP4) [Source:HGNC Symbol;Acc:9596]
Mouse Orthologue:
Ptger4
Mouse Description:
prostaglandin E receptor 4 (subtype EP4) Gene [Source:MGI Symbol;Acc:MGI:104311]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa56 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa56
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082296 Nonsense 40 403 1 2
Genomic Location (Zv9):
Chromosome 8 (position 1007637)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 846908
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGTGGTGCTCTGCAAGTCCCGCAGAGAGCAGAAGGAGACCACCTTTTA[T/A]ACCCTGGTGTGCGGGCTGGCGGTCACGGATCTCCTGGGCACCGTGTTGGC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ankylosing spondylitis: Interaction between ERAP1 and HLA-B27 in ankylosing spondylitis implicates peptide handling in the mechanism for HLA-B27 in disease susceptibility. (View Study)
  • Crohn's disease: A genome-wide association study on a southern European population identifies a new Crohn's disease susceptibility locus at RBX1-EP300. (View Study)
  • Crohn's disease: A genome-wide scan of Ashkenazi Jewish Crohn's disease suggests novel susceptibility loci. (View Study)
  • Crohn's disease: Genome-wide association defines more than 30 distinct susceptibility loci for Crohn's disease. (View Study)
  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Crohn's disease: Systematic association mapping identifies NELL1 as a novel IBD disease gene. (View Study)
  • Gastric cancer: A genome-wide association study identifies new susceptibility loci for non-cardia gastric cancer at 3q13.31 and 5p13.1. (View Study)
  • Multiple sclerosis: Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis. (View Study)
  • Multiple sclerosis: Genome-wide association study of multiple sclerosis confirms a novel locus at 5p13.1. (View Study)
  • Multiple sclerosis: Meta-analysis of genome scans and replication identify CD6, IRF8 and TNFRSF1A as new multiple sclerosis susceptibility loci. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link