runx2b

Ensembl ID:
ENSDARG00000059233
ZFIN IDs:
ZDB-GENE-040629-4, ZDB-GENE-040629-4, ZDB-GENE-040629-4, ZDB-GENE-040629-4, ZDB-GENE-040629-4
Description:
runt-related transcription factor 2b [Source:RefSeq peptide;Acc:NP_998027]
Human Orthologue:
RUNX2
Human Description:
runt-related transcription factor 2 [Source:HGNC Symbol;Acc:10472]
Mouse Orthologue:
Runx2
Mouse Description:
runt related transcription factor 2 Gene [Source:MGI Symbol;Acc:MGI:99829]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32315 Nonsense Available for shipment Available now
sa25144 Nonsense Mutation detected in F1 DNA During 2016
sa14504 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32315
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048978   None 328 None 5
ENSDART00000082265 Nonsense 140 463 3 8
ENSDART00000082276   None 327 None 8
ENSDART00000082283   None 181 None 2
ENSDART00000125384   None 37 None 2
ENSDART00000125898 Nonsense 126 450 2 8
ENSDART00000130609 Nonsense 178 502 4 8
Genomic Location (Zv9):
Chromosome 20 (position 44085019)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 44156178
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGAATTATTCAGCGGAGCTCAGGAATGCCTCAGGGGTTATGAAGAAC[C/T]AGGTGGCCCGCTTCAATGACCTGCGCTTTGTGGGACGAAGCGGAAGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25144
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048978   None 328 None 5
ENSDART00000082265 Nonsense 152 463 3 8
ENSDART00000082276   None 327 None 8
ENSDART00000082283   None 181 None 2
ENSDART00000125384   None 37 None 2
ENSDART00000125898 Nonsense 138 450 2 8
ENSDART00000130609 Nonsense 190 502 4 8
Genomic Location (Zv9):
Chromosome 20 (position 44084983)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 44156142
KASP Assay ID:
554-7459.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTTATGAAGAACCAGGTGGCCCGCTTCAATGACCTGCGCTTTGTGGGA[C/T]GAAGCGGAAGAGGTCAGTACATCTTATGATTTTTTTATTTATTTAGTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14504
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048978 Nonsense 115 328 4 5
ENSDART00000082265 Nonsense 251 463 6 8
ENSDART00000082276 Nonsense 114 327 7 8
ENSDART00000082283   None 181 None 2
ENSDART00000125384   None 37 None 2
ENSDART00000125898 Nonsense 237 450 5 8
ENSDART00000130609 Nonsense 289 502 7 8
Genomic Location (Zv9):
Chromosome 20 (position 44037670)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 44108829
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTTTTATTTATTTTTTACCCATCCTCTTGTTTGTTCCTTCAGATCCA[C/T]GACAGGCTCAATCTTCCCCACCATGGTCATACGACCAGACATACCCATCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link