runx2b

Ensembl ID:
ENSDARG00000059233
ZFIN IDs:
ZDB-GENE-040629-4, ZDB-GENE-040629-4, ZDB-GENE-040629-4, ZDB-GENE-040629-4, ZDB-GENE-040629-4
Description:
runt-related transcription factor 2b [Source:RefSeq peptide;Acc:NP_998027]
Human Orthologue:
RUNX2
Human Description:
runt-related transcription factor 2 [Source:HGNC Symbol;Acc:10472]
Mouse Orthologue:
Runx2
Mouse Description:
runt related transcription factor 2 Gene [Source:MGI Symbol;Acc:MGI:99829]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25144 Nonsense Mutation detected in F1 DNA During 2014
sa14504 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25144
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048978 None None 328 None 5
ENSDART00000082265 Nonsense 152 463 3 8
ENSDART00000082276 None None 327 None 8
ENSDART00000082283 None None 181 None 2
ENSDART00000125384 None None 37 None 2
ENSDART00000125898 Nonsense 138 450 2 8
ENSDART00000130609 Nonsense 190 502 4 8
Genomic Location:
Chromosome 20 (position 44084983)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTTATGAAGAACCAGGTGGCCCGCTTCAATGACCTGCGCTTTGTGGGA[C/T]GAAGCGGAAGAGGTCAGTACATCTTATGATTTTTTTATTTATTTAGTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14504
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048978 Nonsense 115 328 4 5
ENSDART00000082265 Nonsense 251 463 6 8
ENSDART00000082276 Nonsense 114 327 7 8
ENSDART00000082283 None None 181 None 2
ENSDART00000125384 None None 37 None 2
ENSDART00000125898 Nonsense 237 450 5 8
ENSDART00000130609 Nonsense 289 502 7 8
Genomic Location:
Chromosome 20 (position 44037670)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTTTTATTTATTTTTTACCCATCCTCTTGTTTGTTCCTTCAGATCCA[C/T]GACAGGCTCAATCTTCCCCACCATGGTCATACGACCAGACATACCCATCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fa2pk9tg