CIAO1_DANRE

Ensembl ID:
ENSDARG00000059212
Description:
Probable cytosolic iron-sulfur protein assembly protein ciao1 [Source:UniProtKB/Swiss-Prot;Acc:Q6P0D
Human Orthologue:
CIAO1
Human Description:
cytosolic iron-sulfur protein assembly 1 [Source:HGNC Symbol;Acc:14280]
Mouse Orthologue:
Ciao1
Mouse Description:
cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:134

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8858 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8858
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082256 Nonsense 69 330 2 7

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 8 (position 4994521)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGTGTGTCCTTTCTGATGGACACCAGCGCACAGTCAGAAAAGTAGCCT[G/A]GTCTCCCTGTGGGAAATACCTGGCTTCAGCCAGCTTTGATGCCACGACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8ru45ysr