si:ch73-181d5.2

Ensembl ID:
ENSDARG00000059202
ZFIN ID:
ZDB-GENE-100922-60
Human Orthologue:
TSPAN2
Human Description:
tetraspanin 2 [Source:HGNC Symbol;Acc:20659]
Mouse Orthologue:
Tspan2
Mouse Description:
tetraspanin 2 Gene [Source:MGI Symbol;Acc:MGI:1917997]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10541 Nonsense Available for shipment Available now
sa5975 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa10541
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021204 Nonsense 57 217 3 10
ENSDART00000132268   None 48 None 2
ENSDART00000146776 Nonsense 59 163 3 6
Genomic Location (Zv9):
Chromosome 23 (position 446714)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 417705
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGCCSGAATGAGCTTAAATAATRTGTGTGTYCTGCACAGGGGYGTA[C/A]ATCCTCATCGCAGCCGGTGGTCTGGTGATGCTGGTGGGTTTTTTCGGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5975
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021204 Nonsense 162 217 8 10
ENSDART00000132268   None 48 None 2
ENSDART00000146776   None 163 None 6
Genomic Location (Zv9):
Chromosome 23 (position 442615)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 413606
KASP Assay ID:
554-3684.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCACTGAGTTCAGCTYCCAGCCATTAGTAGAACAGCACCTACTGGGT[G/A]GGCGGGGCTTAAGATAGWATCACCCCATCTGATTGGTCAAATTTGGATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link