tlk1b

Ensembl ID:
ENSDARG00000059190
ZFIN ID:
ZDB-GENE-030131-4933
Description:
Serine/threonine-protein kinase tousled-like 1-B [Source:UniProtKB/Swiss-Prot;Acc:Q90ZY6]
Human Orthologue:
TLK1
Human Description:
tousled-like kinase 1 [Source:HGNC Symbol;Acc:11841]
Mouse Orthologue:
Tlk1
Mouse Description:
tousled-like kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2441683]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1341 Essential Splice Site Available for shipment Available now
sa8217 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1341
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009936 Essential Splice Site 276 756 9 21
ENSDART00000082219 Essential Splice Site 276 756 9 21
Genomic Location:
Chromosome 6 (position 3712689)
KASP Assay ID:
554-1255.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGTCTGAACAAATGCACTACGATGAGTAAAAAACTCCTGATTGAGAAGG[T/C]AAGCTGTGTCTTATGTGCTTGCAGMTGTGTATACATRTGCCGATATATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8217
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009936 Nonsense 282 756 10 21
ENSDART00000082219 Nonsense 282 756 10 21
Genomic Location:
Chromosome 6 (position 3710416)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGTTGACCCTCAAGTGTGTTTTCGTCTCACTAGARCACTCAAGAGAAA[C/T]AGTCCTGCCGGGAAAAGAGCATGCAGGACCGGCTGCGTCTRGGACACTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7pjmz3uh