irbp

Ensembl ID:
ENSDARG00000059163
ZFIN ID:
ZDB-GENE-990415-132
Description:
Interphotoreceptor retinoid-binding protein [Source:UniProtKB/TrEMBL;Acc:O57689]
Human Orthologue:
RBP3
Human Description:
retinol binding protein 3, interstitial [Source:HGNC Symbol;Acc:9921]
Mouse Orthologue:
Rbp3
Mouse Description:
retinol binding protein 3, interstitial Gene [Source:MGI Symbol;Acc:MGI:97878]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41931 Nonsense Mutation detected in F1 DNA During 2016
sa5849 Nonsense Mutation detected in F1 DNA During 2016
sa11103 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41931
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082200 Nonsense 659 1202 1 5
ENSDART00000082203   None 627 None 5
ENSDART00000147532   None 631 None 4
Genomic Location:
Chromosome 12 (position 3240971)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACCGAGGGACTGTACCGCTCTGTTGTCGACTATGAATCTCTTGCATCT[C/T]AGCTCACTTCAGATCTCCAAGAGACCTCGGGTGATCAGAGACTGCATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5849
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082200 Nonsense 884 1202 1 5
ENSDART00000082203   None 627 None 5
ENSDART00000147532   None 631 None 4
Genomic Location:
Chromosome 12 (position 3241646)
KASP Assay ID:
554-3801.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCAGTTCTGAATGCAGTTACTGGAAAACCATGGAGCATTTCAGGAGTT[G/T]AACCACATATAGTAGCTCAAGCAAGTGATGCACTTATTGTTGCACAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11103
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082200 Nonsense 1101 1202 5 5
ENSDART00000082203 Nonsense 514 627 4 5
ENSDART00000147532 Nonsense 530 631 4 4
Genomic Location:
Chromosome 12 (position 3247655)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACTGATGCATTAAATTCCACTTTTCYCTAGGCAGRAGATATGGMAGC[A/T]AGAAAAGTGTGGTAATCCTCACCAGTGGTGTGACCGCCGGTGCCGCTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link