irbp

Ensembl ID:
ENSDARG00000059163
ZFIN ID:
ZDB-GENE-990415-132
Description:
Interphotoreceptor retinoid-binding protein [Source:UniProtKB/TrEMBL;Acc:O57689]
Human Orthologue:
RBP3
Human Description:
retinol binding protein 3, interstitial [Source:HGNC Symbol;Acc:9921]
Mouse Orthologue:
Rbp3
Mouse Description:
retinol binding protein 3, interstitial Gene [Source:MGI Symbol;Acc:MGI:97878]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5849 Nonsense Mutation detected in F1 DNA During 2014
sa11103 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5849
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082200 Nonsense 884 1202 1 5
ENSDART00000082203 None None 627 None 5
ENSDART00000147532 None None 631 None 4
Genomic Location:
Chromosome 12 (position 3241646)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCAGTTCTGAATGCAGTTACTGGAAAACCATGGAGCATTTCAGGAGTT[G/T]AACCACATATAGTAGCTCAAGCAAGTGATGCACTTATTGTTGCACAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11103
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082200 Nonsense 1101 1202 5 5
ENSDART00000082203 Nonsense 514 627 4 5
ENSDART00000147532 Nonsense 530 631 4 4
Genomic Location:
Chromosome 12 (position 3247655)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACTGATGCATTAAATTCCACTTTTCYCTAGGCAGRAGATATGGMAGC[A/T]AGAAAAGTGTGGTAATCCTCACCAGTGGTGTGACCGCCGGTGCCGCTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jkoowjbz