si:dkey-218f9.9

Ensembl ID:
ENSDARG00000059154
ZFIN ID:
ZDB-GENE-070705-380
Description:
hypothetical protein LOC100000325 [Source:RefSeq peptide;Acc:NP_001093538]
Human Orthologues:
RRAGC, RRAGD
Human Descriptions:
Ras-related GTP binding C [Source:HGNC Symbol;Acc:19902]
Ras-related GTP binding D [Source:HGNC Symbol;Acc:19903]
Mouse Orthologues:
Rragc, Rragd
Mouse Descriptions:
Ras-related GTP binding C Gene [Source:MGI Symbol;Acc:MGI:1858751]
Ras-related GTP binding D Gene [Source:MGI Symbol;Acc:MGI:1098604]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36762 Nonsense Mutation detected in F1 DNA During 2017
sa29138 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36762
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082187 Nonsense 118 392 2 7
Genomic Location (Zv9):
Chromosome 19 (position 4930265)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4203826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGGACAGGTGGACTTTTTCGACCCTACTTTTGACTACGAGATGATTTTC[A/T]GAGGCACCGGCGCATTGATTTTCGTCATTGATGCTCAGGTAAGTATGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29138
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082187 Essential Splice Site 197 392 3 7
Genomic Location (Zv9):
Chromosome 19 (position 4928040)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4201601
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCCAATGATGATCTTGCTGACGCCAGTCTGGAAAAGCTTCACCTCAG[G/A]TTGGTAAAACTGATTTAAAAACCAGATCAGTCTGCCTTCAAGCTAATGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link