LOC570642

Ensembl ID:
ENSDARG00000059139
Human Orthologue:
WFIKKN2
Human Description:
WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2 [Source:HGNC Symbol;Ac
Mouse Orthologue:
Wfikkn2
Mouse Description:
WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2 Gene [Source:MGI Symbo

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4443 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4443
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082169 Nonsense 43 563 1 2
Genomic Location:
Chromosome 12 (position 1001996)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAGAGGCATGACTTTGCAAGGAGTTGCGAATTCCCACGCAGGGATCTG[T/A]CCAAACGACATGAACCCAAACCTGTGGGTTGATGCAATGAGCACCTGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p0zhuru4