plcd1a

Ensembl ID:
ENSDARG00000059123
ZFIN ID:
ZDB-GENE-071004-78
Description:
phospholipase C, delta 1a [Source:RefSeq peptide;Acc:NP_001103170]
Human Orthologue:
PLCD1
Human Description:
phospholipase C, delta 1 [Source:HGNC Symbol;Acc:9060]
Mouse Orthologue:
Plcd1
Mouse Description:
phospholipase C, delta 1 Gene [Source:MGI Symbol;Acc:MGI:97614]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39444 Nonsense Mutation detected in F1 DNA During 2017
sa24480 Essential Splice Site Available for shipment Available now
sa44121 Nonsense Mutation detected in F1 DNA During 2017
sa9594 Nonsense Available for shipment Available now
sa10380 Nonsense Available for shipment Available now
sa37870 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11302 Nonsense Available for shipment Available now
sa17762 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39444
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112349 Nonsense 109 775 3 15
ENSDART00000132340 Nonsense 109 775 4 16
ENSDART00000139989 Nonsense 86 154 3 4
Genomic Location (Zv9):
Chromosome 24 (position 21000345)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20247474
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTCTGTGCGTCTCGGCCGACAGTCTGAAGGACTGCAGAAATACACATA[T/A]TCCTCGATTGAGAATCGCTGCTTCTCCATCATCTTCAAAGGTAGACGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24480
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112349 Essential Splice Site 163 775 3 15
ENSDART00000132340 Essential Splice Site 163 775 4 16
ENSDART00000139989 Essential Splice Site 140 154 3 4
Genomic Location (Zv9):
Chromosome 24 (position 21000508)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20247637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTTATCAACCGCCTGCATAAACTCAATCGCCAACAGAACAGTGAACAG[T/C]ATCCTTGAACATGCATCTTTCCCAATTCCCTACAAAAAAAGTCTATTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44121
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112349 Nonsense 332 775 6 15
ENSDART00000132340 Nonsense 332 775 7 16
ENSDART00000139989   None 154 None 4
Genomic Location (Zv9):
Chromosome 24 (position 21005790)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20252919
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCAGCAGCCATTGAATCATTACTTCATTTCATCTTCCCATAACACTTA[T/A]CTGATGGAGGACCAGCTGAAGGGGCCCAGCAGCACAGAAGCCTATATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9594
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112349 Nonsense 401 775 8 15
ENSDART00000132340 Nonsense 401 775 9 16
ENSDART00000139989   None 154 None 4
ENSDART00000112349 Nonsense 401 775 8 15
ENSDART00000132340 Nonsense 401 775 9 16
ENSDART00000139989   None 154 None 4
Genomic Location (Zv9):
Chromosome 24 (position 21008864)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20255993
KASP Assay ID:
2261-8645.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTTTGTGGATTATGWTTTCGTTTTTTTGTCACTCYAGGCCTCACCRTA[T/A]CCAGTGMTCTTGTCTTTGGAGAACCATTGTTCTTTAGAGCAGCAGAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10380
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112349 Nonsense 401 775 8 15
ENSDART00000132340 Nonsense 401 775 9 16
ENSDART00000139989   None 154 None 4
ENSDART00000112349 Nonsense 401 775 8 15
ENSDART00000132340 Nonsense 401 775 9 16
ENSDART00000139989   None 154 None 4
Genomic Location (Zv9):
Chromosome 24 (position 21008864)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20255993
KASP Assay ID:
2261-8645.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTTTGTGGATTATGWTTTCGTTTTTTTGTCACTCYAGGCCTCACCRTA[T/A]CCAGTGMTCTTGTCTTTGGAGAACCATTGTTCTTTAGAGCAGCAGAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37870
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112349 Essential Splice Site 499 775 9 15
ENSDART00000132340 Essential Splice Site 499 775 10 16
ENSDART00000139989   None 154 None 4
Genomic Location (Zv9):
Chromosome 24 (position 21016542)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20263671
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGGCTGCCGATCTGAAAGAGGGTGAACCCACACACAAAGATTCGAAGG[T/C]GTGTTTAAGACCCAAAACCAGCAAGAGCTGTACCCACAGACCCGAGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11302
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112349 Nonsense 532 775 10 15
ENSDART00000132340 Nonsense 532 775 11 16
ENSDART00000139989   None 154 None 4
Genomic Location (Zv9):
Chromosome 24 (position 21017055)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20264184
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTACTGCAAGAGTGTGCATTTCRCCAGCTTYGAGCAATCAAGGAAAAAA[C/T]AGGCCTTCTATGAGATGGCTTCCTTCAAGGAGGGCAAAGCCATGAACTYA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17762
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112349 Nonsense 551 775 10 15
ENSDART00000132340 Nonsense 551 775 11 16
ENSDART00000139989   None 154 None 4
Genomic Location (Zv9):
Chromosome 24 (position 21017112)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20264241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTATGAGATGGCTTCCTTCAAGGAGGGCAAAGCCATGAACTYAGCTGAA[C/T]AATCAGGTACAAGGGWATGCAGGGTGTGCTRAGTTGTGGASTATTTTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link